Galaxy History ' RSEM'


DatasetAnnotation
2: Ptrichocarpa_129_gene_formated_to_rsem.gtf
~520,000 lines
format: gtf, database: Populus_unmasked
1.Seqname2.Source3.Feature4.Start5.End6.Score7.Strand8.Frame9.Attributes
scaffold_1Ptrichocarpav2_0exon1263212650.+.gene_id "POPTR_0001s00200"; transcript_id "POPTR_0001s00200.1";
scaffold_1Ptrichocarpav2_05UTR1263212638.+.gene_id "POPTR_0001s00200"; transcript_id "POPTR_0001s00200.1";
scaffold_1Ptrichocarpav2_0CDS1263912650.+0gene_id "POPTR_0001s00200"; transcript_id "POPTR_0001s00200.1";
scaffold_1Ptrichocarpav2_0exon1276812891.+.gene_id "POPTR_0001s00200"; transcript_id "POPTR_0001s00200.1";
scaffold_1Ptrichocarpav2_0CDS1276812891.+0gene_id "POPTR_0001s00200"; transcript_id "POPTR_0001s00200.1";
scaffold_1Ptrichocarpav2_0exon1311713226.+.gene_id "POPTR_0001s00200"; transcript_id "POPTR_0001s00200.1";
awk '{gsub("gene_name","gene_id")Xprint}' Ptrichocarpa_129_gene.gtf > Ptrichocarpa_129_gene_formated_rsem.gtf
3: Ptrichocarpa_129_gene.gtf
~520,000 lines
format: gtf, database: Populus_unmasked
Info: uploaded gtf file
1.Seqname2.Source3.Feature4.Start5.End6.Score7.Strand8.Frame9.Attributes
scaffold_1Ptrichocarpav2_0exon1263212650.+.gene_name "POPTR_0001s00200"; transcript_id "POPTR_0001s00200.1";
scaffold_1Ptrichocarpav2_05UTR1263212638.+.gene_name "POPTR_0001s00200"; transcript_id "POPTR_0001s00200.1";
scaffold_1Ptrichocarpav2_0CDS1263912650.+0gene_name "POPTR_0001s00200"; transcript_id "POPTR_0001s00200.1";
scaffold_1Ptrichocarpav2_0exon1276812891.+.gene_name "POPTR_0001s00200"; transcript_id "POPTR_0001s00200.1";
scaffold_1Ptrichocarpav2_0CDS1276812891.+0gene_name "POPTR_0001s00200"; transcript_id "POPTR_0001s00200.1";
scaffold_1Ptrichocarpav2_0exon1311713226.+.gene_name "POPTR_0001s00200"; transcript_id "POPTR_0001s00200.1";
None
4: Populus_trichocarpa.v2.fa
2,518 sequences
format: fasta, database: Populus_unmasked
Info: uploaded fasta file
>scaffold_1
TGAGCTAAATAACAGAAAATGCATTAGATTACTTGGATGGACTAGACTAAGAGATGAGGCGATATGTTATATTACACAAA
AAACTAAAAGCCATCAGTAAAACACTATAGCCATAGTCACATTTCTCTATTTATTGGAACAATGAAATGATGTTTATACA
CTTAGACAAAATACTTAAGAGGCTTGCAATTAGGGGTAGAATCGTCTTTCACAGGAGATCTATTAGTCATTGCAAAATTA
ATTGGGGACAAATTGTTCGTGAAACCTTTTTATCACAGTAAAATGATTATTTTGCTCTTAAAAGCAAAAAAAATGTTAAG
CTTGTGATCATGAACTTTTTTATCTTTTCAAAAAAACATTGCACTATAAAGTTATAGTCATACCCTTGGGAGGAAAAAAA
None
5: Ptrichocarpa_129_gene.gff3 after removed PACid
~610,000 lines
format: gff3, database: Populus_unmasked
1.Seqid2.Source3.Type4.Start5.End6.Score7.Strand8.Phase9.Attributes
scaffold_1Ptrichocarpav2_0gene1263213612.+.ID=POPTR_0001s00200;Name=POPTR_0001s00200
scaffold_1Ptrichocarpav2_0mRNA1263213612.+.ID=POPTR_0001s00200.1;Name=POPTR_0001s00200.1;;Parent=POPTR_0001s00200
scaffold_1Ptrichocarpav2_0exon1263212650.+.Parent=POPTR_0001s00200.1;
scaffold_1Ptrichocarpav2_05'-UTR1263212638.+.Parent=POPTR_0001s00200.1;
scaffold_1Ptrichocarpav2_0CDS1263912650.+0Parent=POPTR_0001s00200.1;
scaffold_1Ptrichocarpav2_0exon1276812891.+.Parent=POPTR_0001s00200.1;
gawk '{sub(/PACid=*[0-9]*[0-9]/, "");print}' Ptrichocarpa_129_gene.gff3 > Ptrichocarpa_129_gene_removed_PACids.gff3
6: Ptrichocarpa_129_gene.gff3 after removed PACid _to_GTF on data 5
~460,000 lines
format: gtf, database: Populus_unmasked
1.Seqname2.Source3.Feature4.Start5.End6.Score7.Strand8.Frame9.Attributes
##gff-version 2.5
scaffold_1Ptrichocarpav2_0EXON1263212650.+0gene_id "POPTR_0001s00200"; transcript_id "POPTR_0001s00200.1";
scaffold_1Ptrichocarpav2_0CDS1263912650.+0gene_id "POPTR_0001s00200"; transcript_id "POPTR_0001s00200.1";
scaffold_1Ptrichocarpav2_0EXON1276812891.+0gene_id "POPTR_0001s00200"; transcript_id "POPTR_0001s00200.1";
scaffold_1Ptrichocarpav2_0CDS1276812891.+0gene_id "POPTR_0001s00200"; transcript_id "POPTR_0001s00200.1";
scaffold_1Ptrichocarpav2_0EXON1311713226.+0gene_id "POPTR_0001s00200"; transcript_id "POPTR_0001s00200.1";
Converted GFF3 to GTF using Galaxy tool
7: Final.gtf use for RSEM input
~520,000 lines
format: gtf, database: Populus_unmasked
Info: uploaded gtf file
1.Seqname2.Source3.Feature4.Start5.End6.Score7.Strand8.Frame9.Attributes
scaffold_1Ptrichocarpav2_0exon1263212650.+.gene_id "POPTR_0001s00200"; transcript_id "POPTR_0001s00200.1";
scaffold_1Ptrichocarpav2_05UTR1263212638.+.gene_id "POPTR_0001s00200"; transcript_id "POPTR_0001s00200.1";
scaffold_1Ptrichocarpav2_0CDS1263912650.+0gene_id "POPTR_0001s00200"; transcript_id "POPTR_0001s00200.1";
scaffold_1Ptrichocarpav2_0exon1276812891.+.gene_id "POPTR_0001s00200"; transcript_id "POPTR_0001s00200.1";
scaffold_1Ptrichocarpav2_0CDS1276812891.+0gene_id "POPTR_0001s00200"; transcript_id "POPTR_0001s00200.1";
scaffold_1Ptrichocarpav2_0exon1311713226.+.gene_id "POPTR_0001s00200"; transcript_id "POPTR_0001s00200.1";
This use for RSEM input to make reference dataset
8: Input.fq
136.7 Mb
format: fastqsanger, database: Populus_unmasked
Info: uploaded fastq file
@SOLEXA14:5:1:1:1424#0/2
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+SOLEXA14:5:1:1:1424#0/2
BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
@SOLEXA14:5:1:2:1420#0/2
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
None
9: Results.gene_abundances
41,377 lines
format: tabular, database: Populus_unmasked
1234
POPTR_0001s002000.000POPTR_0001s00200.1
POPTR_0001s002100.000POPTR_0001s00210.1
POPTR_0001s002201.001.88266459073172e-06POPTR_0001s00220.1
POPTR_0001s002300.000POPTR_0001s00230.1
POPTR_0001s002401.001.78973533233641e-06POPTR_0001s00240.1
POPTR_0001s0025046.444.23800195186023e-05POPTR_0001s00250.1
10: Results.isoform_abundances
45,778 lines
format: tabular, database: Populus_unmasked
1234
POPTR_0001s00200.10.000POPTR_0001s00200
POPTR_0001s00210.10.000POPTR_0001s00210
POPTR_0001s00220.11.001.88266459073172e-06POPTR_0001s00220
POPTR_0001s00230.10.000POPTR_0001s00230
POPTR_0001s00240.11.001.78973533233641e-06POPTR_0001s00240
POPTR_0001s00250.146.444.23800195186023e-05POPTR_0001s00250
11: Results.transcript.bam
40.7 Mb
format: bam, database: Populus_unmasked
Binary bam alignments file
12: Results.rsem_log
10 lines
format: txt, database: Populus_unmasked
RSEM Parameters used by Galaxy:
/usr/local/bin/rsem-calculate-expression --quiet -p 1 --forward-prob 0.5 --seed-length 25 --bowtie-n 2 --bowtie-e 99999999 --bowtie-m 200 --fragment-length-mean -1 --phred33-quals /mnt/spruce/storage/ftp/database/files/001/dataset_1753.dat /mnt/spruce/stor
age/data/rsem/Populus /mnt/spruce/storage/ftp/database/files/001/dataset_1804.dat
bowtie -q --phred33-quals -n 2 -e 99999999 -l 25 -p 1 -a -m 200 -S --quiet /mnt/spruce/storage/data/rsem/Populus /mnt/spruce/storage/ftp/database/files/001/dataset_1753.dat | gzip > /mnt/spruce/storage/ftp/database/files/001/dataset_1804.dat.sam.gz
/usr/local/bin/rsem-parse-alignments /mnt/spruce/storage/data/rsem/Populus /mnt/spruce/storage/ftp/database/files/001/dataset_1804.dat dataset_1804.dat s /mnt/spruce/storage/ftp/database/files/001/dataset_1804.dat.sam.gz -t 1 -tag XM -q