Published Histories | chanaka | RNASeq Analysis with Random fastq reads
Import history

Galaxy History ' RNASeq Analysis with Random fastq reads'


DatasetAnnotation
1: Random fastq extract tool on data 2 and data 1
13.6 Mb
format: fastqsanger, database: ?
@SOLEXA14:5:1:11:122#0/1
GCCTTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+SOLEXA14:5:1:11:122#0/1
BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
@SOLEXA14:5:1:23:957#0/1
CGATTTCATCGCCAGCACGGATCTCCTGCCGGATCCCAACCCGTATCCCAC
2: Random fastq extract tool on data 2 and data 1
13.6 Mb
format: fastqsanger, database: ?
@SOLEXA14:5:1:11:122#0/2
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+SOLEXA14:5:1:11:122#0/2
BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
@SOLEXA14:5:1:23:957#0/2
CTCGCTAAGAAACCGAAAGCAGAAAAGGAAACGAAAATGGCGACTCATAGA
3: Random fastq extract tool on data 4 and data 3
14.3 Mb
format: fastqsanger, database: ?
@SOLEXA14:2:1:8:1669#0/2
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+SOLEXA14:2:1:8:1669#0/2
BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
@SOLEXA14:2:1:10:263#0/2
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
4: Random fastq extract tool on data 4 and data 3
14.3 Mb
format: fastqsanger, database: ?
@SOLEXA14:2:1:8:1669#0/1
AGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+SOLEXA14:2:1:8:1669#0/1
BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
@SOLEXA14:2:1:10:263#0/1
TGGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
5: FASTQ Groomer on data 1
13.6 Mb
format: fastqsanger, database: ?
Info: Groomed 89620 sanger reads into sanger reads.
Based upon quality and sequence, the input data is valid for: solexa, sanger, illumina
Input ASCII range: 'B'(66) - 'h'(104)
Input decimal range: 33 - 71
@SOLEXA14:5:1:11:122#0/1
GCCTTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+SOLEXA14:5:1:11:122#0/1
BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
@SOLEXA14:5:1:23:957#0/1
CGATTTCATCGCCAGCACGGATCTCCTGCCGGATCCCAACCCGTATCCCAC
6: FASTQ Groomer on data 2
13.6 Mb
format: fastqsanger, database: ?
Info: Groomed 89620 sanger reads into sanger reads.
Based upon quality and sequence, the input data is valid for: solexa, sanger, illumina
Input ASCII range: 'B'(66) - 'h'(104)
Input decimal range: 33 - 71
@SOLEXA14:5:1:11:122#0/2
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+SOLEXA14:5:1:11:122#0/2
BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
@SOLEXA14:5:1:23:957#0/2
CTCGCTAAGAAACCGAAAGCAGAAAAGGAAACGAAAATGGCGACTCATAGA
7: FASTQ Groomer on data 3
14.3 Mb
format: fastqsanger, database: ?
Info: Groomed 93908 sanger reads into sanger reads.
Based upon quality and sequence, the input data is valid for: solexa, sanger, illumina
Input ASCII range: 'B'(66) - 'h'(104)
Input decimal range: 33 - 71
@SOLEXA14:2:1:8:1669#0/2
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+SOLEXA14:2:1:8:1669#0/2
BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
@SOLEXA14:2:1:10:263#0/2
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
8: FASTQ Groomer on data 4
14.3 Mb
format: fastqsanger, database: ?
Info: Groomed 93908 sanger reads into sanger reads.
Based upon quality and sequence, the input data is valid for: solexa, sanger, illumina
Input ASCII range: 'B'(66) - 'h'(104)
Input decimal range: 33 - 71
@SOLEXA14:2:1:8:1669#0/1
AGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+SOLEXA14:2:1:8:1669#0/1
BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
@SOLEXA14:2:1:10:263#0/1
TGGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
9: Trim sequences on data 5
8.5 Mb
format: fastqsanger, database: ?
Info: Trimming: base 1 to 21
Input: 89620 reads.
Output: 89620 reads.
@SOLEXA14:5:1:11:122#0/1
GCCTTANNNNNNNNNNNNNNN
+SOLEXA14:5:1:11:122#0/1
BBBBBBBBBBBBBBBBBBBBB
@SOLEXA14:5:1:23:957#0/1
CGATTTCATCGCCAGCACGGA
10: FastQC.html
8.3 Kb
format: html, database: ?
Info: moved /mnt/spruce/storage/ftp/database/job_working_directory/1158/dataset_1406_files/dataset_1401.dat_fastqc/Icons/error.png to /mnt/spruce/storage/ftp/database/job_working_directory/1158/dataset_1406_files/error.png
moved /mnt/spruce/storage/ftp/database
HTML file
11: Trim sequences on data 6
8.5 Mb
format: fastqsanger, database: ?
Info: Trimming: base 1 to 21
Input: 89620 reads.
Output: 89620 reads.
@SOLEXA14:5:1:11:122#0/2
NNNNNNNNNNNNNNNNNNNNN
+SOLEXA14:5:1:11:122#0/2
BBBBBBBBBBBBBBBBBBBBB
@SOLEXA14:5:1:23:957#0/2
CTCGCTAAGAAACCGAAAGCA
12: FastQC.html
7.8 Kb
format: html, database: ?
Info: moved /mnt/spruce/storage/ftp/database/job_working_directory/1160/dataset_1408_files/dataset_1402.dat_fastqc/Icons/error.png to /mnt/spruce/storage/ftp/database/job_working_directory/1160/dataset_1408_files/error.png
moved /mnt/spruce/storage/ftp/database
HTML file
13: FastQC.html
8.1 Kb
format: html, database: ?
Info: moved /mnt/spruce/storage/ftp/database/job_working_directory/1161/dataset_1409_files/dataset_1403.dat_fastqc/Icons/error.png to /mnt/spruce/storage/ftp/database/job_working_directory/1161/dataset_1409_files/error.png
moved /mnt/spruce/storage/ftp/database
HTML file
14: Trim sequences on data 7
8.9 Mb
format: fastqsanger, database: ?
Info: Trimming: base 1 to 21
Input: 93908 reads.
Output: 93908 reads.
@SOLEXA14:2:1:8:1669#0/2
NNNNNNNNNNNNNNNNNNNNN
+SOLEXA14:2:1:8:1669#0/2
BBBBBBBBBBBBBBBBBBBBB
@SOLEXA14:2:1:10:263#0/2
NNNNNNNNNNNNNNNNNNNNN
15: FastQC.html
8.6 Kb
format: html, database: ?
Info: moved /mnt/spruce/storage/ftp/database/job_working_directory/1163/dataset_1411_files/dataset_1404.dat_fastqc/Icons/error.png to /mnt/spruce/storage/ftp/database/job_working_directory/1163/dataset_1411_files/error.png
moved /mnt/spruce/storage/ftp/database
HTML file
16: Trim sequences on data 8
8.9 Mb
format: fastqsanger, database: ?
Info: Trimming: base 1 to 21
Input: 93908 reads.
Output: 93908 reads.
@SOLEXA14:2:1:8:1669#0/1
AGANNNNNNNNNNNNNNNNNN
+SOLEXA14:2:1:8:1669#0/1
BBBBBBBBBBBBBBBBBBBBB
@SOLEXA14:2:1:10:263#0/1
TGGCTNNNNNNNNNNNNNNNN
17: Tophat on data 11 and data 9: splice junctions
418 regions, 1 comments
format: bed, database: Populus_unmasked
Info: TopHat v1.4.1
tophat -p 4 -r 20 /mnt/spruce/storage/data/bowtie_old/nisqually /mnt/spruce/storage/ftp/database/files/001/dataset_1405.dat /mnt/spruce/storage/ftp/database/files/001/dataset_1407.dat
view in GeneTrack
display in IGB Local Web
1.Chrom2.Start3.End4.Name56.Strand789101112
track name=junctions description="TopHat junctions"
scaffold_3281952019821JUNC000000011+1952019821255,0,029,120,289
scaffold_649297193463JUNC000000022+9297193463255,0,0218,150,477
scaffold_675288462537JUNC000000031-5288462537255,0,0213,80,9645
scaffold_227779478043JUNC000000041+7779478043255,0,028,130,236
scaffold_22208566208996JUNC000000052-208566208996255,0,028,160,414
18: Tophat on data 11 and data 9: accepted_hits
5.9 Mb
format: bam, database: Populus_unmasked
Info: TopHat v1.4.1
tophat -p 4 -r 20 /mnt/spruce/storage/data/bowtie_old/nisqually /mnt/spruce/storage/ftp/database/files/001/dataset_1405.dat /mnt/spruce/storage/ftp/database/files/001/dataset_1407.dat
Binary bam alignments file
19: Tophat on data 16 and data 14: splice junctions
434 regions, 1 comments
format: bed, database: Populus_unmasked
Info: TopHat v1.4.1
tophat -p 4 -r 20 /mnt/spruce/storage/data/bowtie_old/nisqually /mnt/spruce/storage/ftp/database/files/001/dataset_1410.dat /mnt/spruce/storage/ftp/database/files/001/dataset_1412.dat
view in GeneTrack
display in IGB Local Web
1.Chrom2.Start3.End4.Name56.Strand789101112
track name=junctions description="TopHat junctions"
scaffold_27173869174698JUNC000000011+173869174698255,0,029,120,817
scaffold_27247688248427JUNC000000021+247688248427255,0,029,120,727
scaffold_22406459417644JUNC000000031-406459417644255,0,028,130,11172
scaffold_15342749343132JUNC000000042-342749343132255,0,028,150,368
scaffold_15957449958256JUNC000000052+957449958256255,0,0215,160,791
20: Tophat on data 16 and data 14: accepted_hits
6.2 Mb
format: bam, database: Populus_unmasked
Info: TopHat v1.4.1
tophat -p 4 -r 20 /mnt/spruce/storage/data/bowtie_old/nisqually /mnt/spruce/storage/ftp/database/files/001/dataset_1410.dat /mnt/spruce/storage/ftp/database/files/001/dataset_1412.dat
Binary bam alignments file
21: Cufflinks on data 18: gene expression
372 lines
format: tabular, database: Populus_unmasked
Info: cufflinks v1.3.0
cufflinks -q --no-update-check -I 300000 -F 0.050000 -j 0.050000 -p 4
12345678910111213
tracking_idclass_codenearest_ref_idgene_idgene_short_nametss_idlocuslengthcoverageFPKMFPKM_conf_loFPKM_conf_hiFPKM_status
CUFF.1--CUFF.1--scaffold_1:1217825-1218339--398.669146.529650.81OK
CUFF.2--CUFF.2--scaffold_1:3166391-3167041--488.587217.568759.606OK
CUFF.3--CUFF.3--scaffold_1:3309704-3311012--290.089129.176451.001OK
CUFF.4--CUFF.4--scaffold_1:6699286-6700571--414.249274.289554.209OK
CUFF.5--CUFF.5--scaffold_1:8480633-8481150--394.881145.136644.626OK
22: Cufflinks on data 18: transcript expression
372 lines
format: tabular, database: Populus_unmasked
Info: cufflinks v1.3.0
cufflinks -q --no-update-check -I 300000 -F 0.050000 -j 0.050000 -p 4
12345678910111213
tracking_idclass_codenearest_ref_idgene_idgene_short_nametss_idlocuslengthcoverageFPKMFPKM_conf_loFPKM_conf_hiFPKM_status
CUFF.1.1--CUFF.1--scaffold_1:1217825-12183395141.28192398.669146.529650.81OK
CUFF.2.1--CUFF.2--scaffold_1:3166391-31670415331.45595488.587217.568759.606OK
CUFF.3.1--CUFF.3--scaffold_1:3309704-33110127600.939611290.089129.176451.001OK
CUFF.4.1--CUFF.4--scaffold_1:6699286-670057112851.32388414.249274.289554.209OK
CUFF.5.1--CUFF.5--scaffold_1:8480633-84811505171.19718394.881145.136644.626OK
23: Cufflinks on data 18: assembled transcripts
838 lines
format: gtf, database: Populus_unmasked
Info: cufflinks v1.3.0
cufflinks -q --no-update-check -I 300000 -F 0.050000 -j 0.050000 -p 4
1.Seqname2.Source3.Feature4.Start5.End6.Score7.Strand8.Frame9.Attributes
scaffold_1Cufflinkstranscript121782612183391000..gene_id "CUFF.1"; transcript_id "CUFF.1.1"; FPKM "398.6691427290"; frac "1.000000"; conf_lo "146.528638"; conf_hi "650.809647"; cov "1.281917";
scaffold_1Cufflinksexon121782612183391000..gene_id "CUFF.1"; transcript_id "CUFF.1.1"; exon_number "1"; FPKM "398.6691427290"; frac "1.000000"; conf_lo "146.528638"; conf_hi "650.809647"; cov "1.281917";
scaffold_1Cufflinkstranscript316639231670411000+.gene_id "CUFF.2"; transcript_id "CUFF.2.1"; FPKM "488.5867773042"; frac "1.000000"; conf_lo "217.567596"; conf_hi "759.605959"; cov "1.455952";
scaffold_1Cufflinksexon316639231666861000+.gene_id "CUFF.2"; transcript_id "CUFF.2.1"; exon_number "1"; FPKM "488.5867773042"; frac "1.000000"; conf_lo "217.567596"; conf_hi "759.605959"; cov "1.455952";
scaffold_1Cufflinksexon316680431670411000+.gene_id "CUFF.2"; transcript_id "CUFF.2.1"; exon_number "2"; FPKM "488.5867773042"; frac "1.000000"; conf_lo "217.567596"; conf_hi "759.605959"; cov "1.455952";
scaffold_1Cufflinkstranscript330970533110121000+.gene_id "CUFF.3"; transcript_id "CUFF.3.1"; FPKM "290.0886552749"; frac "1.000000"; conf_lo "129.176421"; conf_hi "451.000889"; cov "0.939611";
24: Cufflinks on data 20: gene expression
574 lines
format: tabular, database: Populus_unmasked
Info: cufflinks v1.3.0
cufflinks -q --no-update-check -I 300000 -F 0.050000 -j 0.050000 -p 4
12345678910111213
tracking_idclass_codenearest_ref_idgene_idgene_short_nametss_idlocuslengthcoverageFPKMFPKM_conf_loFPKM_conf_hiFPKM_status
CUFF.1--CUFF.1--scaffold_1:310722-311502--868.945595.4561142.43OK
CUFF.2--CUFF.2--scaffold_1:667272-668125--185.17668.0604302.292OK
CUFF.3--CUFF.3--scaffold_1:664635-665133--1220.12774.5961665.65OK
CUFF.4--CUFF.4--scaffold_1:2779908-2781061--304.473177.667431.28OK
CUFF.5--CUFF.5--scaffold_1:3265487-3266137--1471.191068.671873.71OK
25: Cufflinks on data 20: transcript expression
575 lines
format: tabular, database: Populus_unmasked
Info: cufflinks v1.3.0
cufflinks -q --no-update-check -I 300000 -F 0.050000 -j 0.050000 -p 4
12345678910111213
tracking_idclass_codenearest_ref_idgene_idgene_short_nametss_idlocuslengthcoverageFPKMFPKM_conf_loFPKM_conf_hiFPKM_status
CUFF.1.1--CUFF.1--scaffold_1:310722-3115027802.808868.945595.4561142.43OK
CUFF.2.1--CUFF.2--scaffold_1:667272-6681258530.644427185.17668.0604302.292OK
CUFF.3.1--CUFF.3--scaffold_1:664635-6651334983.924441220.12774.5961665.65OK
CUFF.4.1--CUFF.4--scaffold_1:2779908-278106111530.953631304.473177.667431.28OK
CUFF.5.1--CUFF.5--scaffold_1:3265487-32661376504.434161471.191068.671873.71OK
26: Cufflinks on data 20: assembled transcripts
1,280 lines
format: gtf, database: Populus_unmasked
Info: cufflinks v1.3.0
cufflinks -q --no-update-check -I 300000 -F 0.050000 -j 0.050000 -p 4
1.Seqname2.Source3.Feature4.Start5.End6.Score7.Strand8.Frame9.Attributes
scaffold_1Cufflinkstranscript3107233115021000..gene_id "CUFF.1"; transcript_id "CUFF.1.1"; FPKM "868.9453512655"; frac "1.008130"; conf_lo "595.456465"; conf_hi "1142.434238"; cov "2.807998";
scaffold_1Cufflinksexon3107233115021000..gene_id "CUFF.1"; transcript_id "CUFF.1.1"; exon_number "1"; FPKM "868.9453512655"; frac "1.008130"; conf_lo "595.456465"; conf_hi "1142.434238"; cov "2.807998";
scaffold_1Cufflinkstranscript6672736681251000..gene_id "CUFF.2"; transcript_id "CUFF.2.1"; FPKM "185.1760155654"; frac "1.000000"; conf_lo "68.060420"; conf_hi "302.291611"; cov "0.644427";
scaffold_1Cufflinksexon6672736681251000..gene_id "CUFF.2"; transcript_id "CUFF.2.1"; exon_number "1"; FPKM "185.1760155654"; frac "1.000000"; conf_lo "68.060420"; conf_hi "302.291611"; cov "0.644427";
scaffold_1Cufflinkstranscript6646366651331000..gene_id "CUFF.3"; transcript_id "CUFF.3.1"; FPKM "1220.1208174979"; frac "1.000000"; conf_lo "774.595688"; conf_hi "1665.645947"; cov "3.924440";
scaffold_1Cufflinksexon6646366651331000..gene_id "CUFF.3"; transcript_id "CUFF.3.1"; exon_number "1"; FPKM "1220.1208174979"; frac "1.000000"; conf_lo "774.595688"; conf_hi "1665.645947"; cov "3.924440";
27: Cuffcompare on data 23, data 41, and data 26: transcript accuracy
30 lines
format: txt, database: Populus_unmasked
Info: cuffcompare v1.3.0 (3022)
cuffcompare -o cc_output -r /mnt/spruce/storage/ftp/database/files/001/dataset_1108.dat -R ./input1 ./input2
# Cuffcompare v1.3.0 | Command line was:
#cuffcompare -o cc_output -r /mnt/spruce/storage/ftp/database/files/001/dataset_1108.dat -R ./input1 ./input2
#
#= Summary for dataset: ./input1 :
# Query mRNAs : 371 in 371 loci (78 multi-exon transcripts)
28: Cuffcompare on data 23, data 41, and data 26: 23 data tmap file
372 lines
format: tabular, database: Populus_unmasked
Info: cuffcompare v1.3.0 (3022)
cuffcompare -o cc_output -r /mnt/spruce/storage/ftp/database/files/001/dataset_1108.dat -R ./input1 ./input2
12345678910111213
ref_gene_idref_idclass_codecuff_gene_idcuff_idFMIFPKMFPKM_conf_loFPKM_conf_hicovlenmajor_iso_idref_match_len
POPTR_0001s01630POPTR_0001s01630.1cCUFF.1CUFF.1.1100398.669143146.528638650.8096471.281917514CUFF.1.11686
POPTR_0001s03980POPTR_0001s03980.1jCUFF.2CUFF.2.1100488.586777217.567596759.6059591.455952533CUFF.2.12268
POPTR_0001s04180POPTR_0001s04180.1jCUFF.3CUFF.3.1100290.088655129.176421451.0008890.939611760CUFF.3.11737
POPTR_0001s08770POPTR_0001s08770.1cCUFF.4CUFF.4.1100414.248928274.289039554.2088171.3238821285CUFF.4.11807
POPTR_0001s10930POPTR_0001s10930.1cCUFF.5CUFF.5.1100394.881214145.136406644.6260221.197181517CUFF.5.11039
29: Cuffcompare on data 23, data 41, and data 26: data 23 refmap file
316 lines
format: tabular, database: Populus_unmasked
Info: cuffcompare v1.3.0 (3022)
cuffcompare -o cc_output -r /mnt/spruce/storage/ftp/database/files/001/dataset_1108.dat -R ./input1 ./input2
1234
ref_gene_idref_idclass_codecuff_id_list
POPTR_0001s11010POPTR_0001s11010.1cCUFF.6|CUFF.6.1
POPTR_0001s11390POPTR_0001s11390.1cCUFF.7|CUFF.7.1
POPTR_0001s11600POPTR_0001s11600.1cCUFF.8|CUFF.8.1
POPTR_0001s13800POPTR_0001s13800.5cCUFF.10|CUFF.10.1
POPTR_0001s13800POPTR_0001s13800.6cCUFF.10|CUFF.10.1
30: Cuffcompare on data 23, data 41, and data 26: data 26 tmap file
575 lines
format: tabular, database: Populus_unmasked
Info: cuffcompare v1.3.0 (3022)
cuffcompare -o cc_output -r /mnt/spruce/storage/ftp/database/files/001/dataset_1108.dat -R ./input1 ./input2
12345678910111213
ref_gene_idref_idclass_codecuff_gene_idcuff_idFMIFPKMFPKM_conf_loFPKM_conf_hicovlenmajor_iso_idref_match_len
POPTR_0001s00410POPTR_0001s00410.1=CUFF.1CUFF.1.1100868.945351595.4564651142.4342382.807998780CUFF.1.1827
POPTR_0001s00820POPTR_0001s00820.1cCUFF.2CUFF.2.1100185.17601668.060420302.2916110.644427853CUFF.2.13434
POPTR_0001s00820POPTR_0001s00820.1cCUFF.3CUFF.3.11001220.120817774.5956881665.6459473.924440498CUFF.3.13434
POPTR_0001s03440POPTR_0001s03440.1cCUFF.4CUFF.4.1100304.473189177.666791431.2795870.9536311153CUFF.4.11774
POPTR_0001s04130POPTR_0001s04130.1oCUFF.5CUFF.5.11001471.1912101068.6709051873.7115164.434165650CUFF.5.1180
31: Cuffcompare on data 23, data 41, and data 26: data 26 refmap file
428 lines
format: tabular, database: Populus_unmasked
Info: cuffcompare v1.3.0 (3022)
cuffcompare -o cc_output -r /mnt/spruce/storage/ftp/database/files/001/dataset_1108.dat -R ./input1 ./input2
1234
ref_gene_idref_idclass_codecuff_id_list
POPTR_0001s00410POPTR_0001s00410.1=CUFF.1|CUFF.1.1
POPTR_0001s11010POPTR_0001s11010.1cCUFF.17|CUFF.17.1
POPTR_0001s11720POPTR_0001s11720.1cCUFF.18|CUFF.18.1
POPTR_0001s13960POPTR_0001s13960.1cCUFF.25|CUFF.25.1
POPTR_0001s16400POPTR_0001s16400.1cCUFF.28|CUFF.28.1
32: Cuffcompare on data 23, data 41, and data 26: transcript tracking
906 lines
format: tabular, database: Populus_unmasked
Info: cuffcompare v1.3.0 (3022)
cuffcompare -o cc_output -r /mnt/spruce/storage/ftp/database/files/001/dataset_1108.dat -R ./input1 ./input2
123456
TCONS_00000001XLOC_000002POPTR_0001s03980|POPTR_0001s03980.1jq1:CUFF.2|CUFF.2.1|100|488.586777|217.567596|759.605959|1.455952|--
TCONS_00000002XLOC_000004POPTR_0001s04180|POPTR_0001s04180.1jq1:CUFF.3|CUFF.3.1|100|290.088655|129.176421|451.000889|0.939611|--
TCONS_00000003XLOC_000005POPTR_0001s11010|POPTR_0001s11010.1cq1:CUFF.6|CUFF.6.1|100|303.026008|128.073861|477.978156|0.935712|695q2:CUFF.17|CUFF.17.1|100|585.703914|355.971938|815.435889|2.000549|737
TCONS_00000004XLOC_000006POPTR_0001s11390|POPTR_0001s11390.1cq1:CUFF.7|CUFF.7.1|100|255.290386|118.831935|391.748837|0.706407|--
TCONS_00000005XLOC_000007POPTR_0001s11600|POPTR_0001s11600.1cq1:CUFF.8|CUFF.8.1|100|1974.151237|1558.001446|2390.301028|6.324867|--
TCONS_00000006XLOC_000010POPTR_0001s13800|POPTR_0001s13800.6cq1:CUFF.10|CUFF.10.1|100|725.698892|429.020666|1022.377117|2.313636|--
33: Cuffcompare on data 23, data 41, and data 26: combined transcripts
1,114 lines
format: gtf, database: Populus_unmasked
Info: cuffcompare v1.3.0 (3022)
cuffcompare -o cc_output -r /mnt/spruce/storage/ftp/database/files/001/dataset_1108.dat -R ./input1 ./input2
1.Seqname2.Source3.Feature4.Start5.End6.Score7.Strand8.Frame9.Attributes
scaffold_1Cufflinksexon310723311502.+.gene_id "XLOC_000001"; transcript_id "TCONS_00000050"; exon_number "1"; gene_name "POPTR_0001s00410"; oId "CUFF.1.1"; nearest_ref "POPTR_0001s00410.1"; class_code "="; tss_id "TSS1";
scaffold_1Cufflinksexon31663923166686.+.gene_id "XLOC_000002"; transcript_id "TCONS_00000001"; exon_number "1"; gene_name "POPTR_0001s03980"; oId "CUFF.2.1"; nearest_ref "POPTR_0001s03980.1"; class_code "j"; tss_id "TSS2";
scaffold_1Cufflinksexon31668043167041.+.gene_id "XLOC_000002"; transcript_id "TCONS_00000001"; exon_number "2"; gene_name "POPTR_0001s03980"; oId "CUFF.2.1"; nearest_ref "POPTR_0001s03980.1"; class_code "j"; tss_id "TSS2";
scaffold_1Cufflinksexon32654883266137.+.gene_id "XLOC_000003"; transcript_id "TCONS_00000051"; exon_number "1"; gene_name "POPTR_0001s04130"; oId "CUFF.5.1"; nearest_ref "POPTR_0001s04130.1"; class_code "o"; tss_id "TSS3";
scaffold_1Cufflinksexon33097053309998.+.gene_id "XLOC_000004"; transcript_id "TCONS_00000002"; exon_number "1"; gene_name "POPTR_0001s04180"; oId "CUFF.3.1"; nearest_ref "POPTR_0001s04180.1"; class_code "j"; tss_id "TSS4";
scaffold_1Cufflinksexon33105473311012.+.gene_id "XLOC_000004"; transcript_id "TCONS_00000002"; exon_number "2"; gene_name "POPTR_0001s04180"; oId "CUFF.3.1"; nearest_ref "POPTR_0001s04180.1"; class_code "j"; tss_id "TSS4";
34: Cuffdiff on data 18, data 20, and data 33: isoform expression
890 lines
format: tabular, database: Populus_unmasked
Info: cuffdiff v1.3.0 (3022)
cuffdiff -q -p 4 -c 1000 --FDR 0.050000 /mnt/spruce/storage/ftp/database/files/001/dataset_1429.dat /mnt/spruce/storage/ftp/database/files/001/dataset_1414.dat /mnt/spruce/storage/ftp/database/files/001/dataset_1416.dat
1234567891011121314
test_idgene_idgenelocussample_1sample_2statusvalue_1value_2log2(fold_change)test_statp_valueq_valuesignificant
TCONS_00000001XLOC_000002POPTR_0001s03980scaffold_1:3166391-3167041q1q2NOTEST3014.86170.778-4.14192.305780.0211231no
TCONS_00000002XLOC_000004POPTR_0001s04180scaffold_1:3309704-3311012q1q2NOTEST1790.01681.542-1.393090.8656950.3866571no
TCONS_00000003XLOC_000005POPTR_0001s11010scaffold_1:8540146-8540883q1q2NOTEST1723.252647.230.619348-0.4437680.6572111no
TCONS_00000004XLOC_000006POPTR_0001s11390scaffold_1:8849278-8850163q1q2NOTEST1575.290-1.79769e+308-1.79769e+3080.08490531no
TCONS_00000005XLOC_000007POPTR_0001s11600scaffold_1:9014251-9015027q1q2NOTEST1244994.4882-7.041684.682132.83907e-061no
35: Cuffdiff on data 18, data 20, and data 33: gene expression
772 lines
format: tabular, database: Populus_unmasked
Info: cuffdiff v1.3.0 (3022)
cuffdiff -q -p 4 -c 1000 --FDR 0.050000 /mnt/spruce/storage/ftp/database/files/001/dataset_1429.dat /mnt/spruce/storage/ftp/database/files/001/dataset_1414.dat /mnt/spruce/storage/ftp/database/files/001/dataset_1416.dat
1234567891011121314
test_idgene_idgenelocussample_1sample_2statusvalue_1value_2log2(fold_change)test_statp_valueq_valuesignificant
XLOC_000001XLOC_000001POPTR_0001s00410scaffold_1:310722-311502q1q2NOTEST03939.431.79769e+3081.79769e+3080.01867751no
XLOC_000002XLOC_000002POPTR_0001s03980scaffold_1:3166391-3167041q1q2NOTEST3014.86170.778-4.14192.305780.0211231no
XLOC_000003XLOC_000003POPTR_0001s04130scaffold_1:3265487-3266137q1q2NOTEST1714.466893.182.00742-1.580270.1140461no
XLOC_000004XLOC_000004POPTR_0001s04180scaffold_1:3311931-3312468q1q2NOTEST2935.762994.870.0287605-0.02446440.9804821no
XLOC_000005XLOC_000005POPTR_0001s11010scaffold_1:8540146-8540883q1q2NOTEST1723.252647.230.619348-0.4437680.6572111no
36: Cuffdiff on data 18, data 20, and data 33: TSS groups expression
885 lines
format: tabular, database: Populus_unmasked
Info: cuffdiff v1.3.0 (3022)
cuffdiff -q -p 4 -c 1000 --FDR 0.050000 /mnt/spruce/storage/ftp/database/files/001/dataset_1429.dat /mnt/spruce/storage/ftp/database/files/001/dataset_1414.dat /mnt/spruce/storage/ftp/database/files/001/dataset_1416.dat
1234567891011121314
test_idgene_idgenelocussample_1sample_2statusvalue_1value_2log2(fold_change)test_statp_valueq_valuesignificant
TSS1XLOC_000001POPTR_0001s00410scaffold_1:310722-311502q1q2NOTEST03939.431.79769e+3081.79769e+3080.01867751no
TSS10XLOC_000009POPTR_0001s11950scaffold_1:9286924-9287524q1q2NOTEST3087.111817.59-0.764230.5178490.6045641no
TSS100XLOC_000085POPTR_0001s31220scaffold_1:29549875-29550355q1q2NOTEST012412.81.79769e+3081.79769e+3080.003972111no
TSS101XLOC_000085POPTR_0001s31220scaffold_1:29550486-29551345q1q2NOTEST977.7529951.123.34732-2.730930.006315631no
TSS102XLOC_000086POPTR_0001s31700scaffold_1:30054810-30055383q1q2NOTEST2901.395884.21.0201-0.7972320.4253161no
37: Cuffdiff on data 18, data 20, and data 33: CDS Expression FPKM Tracking
1 line
format: tabular, database: Populus_unmasked
Info: cuffdiff v1.3.0 (3022)
cuffdiff -q -p 4 -c 1000 --FDR 0.050000 /mnt/spruce/storage/ftp/database/files/001/dataset_1429.dat /mnt/spruce/storage/ftp/database/files/001/dataset_1414.dat /mnt/spruce/storage/ftp/database/files/001/dataset_1416.dat
1234567891011121314
test_idgene_idgenelocussample_1sample_2statusvalue_1value_2log2(fold_change)test_statp_valueq_valuesignificant
38: Cuffdiff on data 18, data 20, and data 33: isoform FPKM tracking
890 lines
format: tabular, database: Populus_unmasked
Info: cuffdiff v1.3.0 (3022)
cuffdiff -q -p 4 -c 1000 --FDR 0.050000 /mnt/spruce/storage/ftp/database/files/001/dataset_1429.dat /mnt/spruce/storage/ftp/database/files/001/dataset_1414.dat /mnt/spruce/storage/ftp/database/files/001/dataset_1416.dat
1234567891011121314151617
tracking_idclass_codenearest_ref_idgene_idgene_short_nametss_idlocuslengthcoverageq1_FPKMq1_conf_loq1_conf_hiq1_statusq2_FPKMq2_conf_loq2_conf_hiq2_status
TCONS_00000001jPOPTR_0001s03980.1XLOC_000002POPTR_0001s03980TSS2scaffold_1:3166391-3167041533-3014.8607487.81OK170.7780512.333OK
TCONS_00000002jPOPTR_0001s04180.1XLOC_000004POPTR_0001s04180TSS4scaffold_1:3309704-3311012760-1790.0104445.74OK681.54201816.98OK
TCONS_00000003cPOPTR_0001s11010.1XLOC_000005POPTR_0001s11010TSS6scaffold_1:8540146-8540883737-1723.2504339.85OK2647.2305821.55OK
TCONS_00000004cPOPTR_0001s11390.1XLOC_000006POPTR_0001s11390TSS7scaffold_1:8849278-8850163885-1575.2903870.26OK000OK
TCONS_00000005cPOPTR_0001s11600.1XLOC_000007POPTR_0001s11600TSS8scaffold_1:9014251-9015027776-124495117.1619780.8OK94.48820283.465OK
39: Cuffdiff on data 18, data 20, and data 33: gene FPKM tracking
772 lines
format: tabular, database: Populus_unmasked
Info: cuffdiff v1.3.0 (3022)
cuffdiff -q -p 4 -c 1000 --FDR 0.050000 /mnt/spruce/storage/ftp/database/files/001/dataset_1429.dat /mnt/spruce/storage/ftp/database/files/001/dataset_1414.dat /mnt/spruce/storage/ftp/database/files/001/dataset_1416.dat
1234567891011121314151617
tracking_idclass_codenearest_ref_idgene_idgene_short_nametss_idlocuslengthcoverageq1_FPKMq1_conf_loq1_conf_hiq1_statusq2_FPKMq2_conf_loq2_conf_hiq2_status
XLOC_000001--XLOC_000001POPTR_0001s00410TSS1scaffold_1:310722-311502--000OK3939.43154.9067723.95OK
XLOC_000002--XLOC_000002POPTR_0001s03980TSS2scaffold_1:3166391-3167041--3014.8607487.81OK170.7780512.333OK
XLOC_000003--XLOC_000003POPTR_0001s04130TSS3scaffold_1:3265487-3266137--1714.4604414.39OK6893.181460.3512326OK
XLOC_000004--XLOC_000004POPTR_0001s04180TSS4,TSS5scaffold_1:3309704-3311012--2935.7606195.13OK2994.8706567.97OK
XLOC_000005--XLOC_000005POPTR_0001s11010TSS6scaffold_1:8540146-8540883--1723.2504339.85OK2647.2305821.55OK
40: Cuffdiff on data 18, data 20, and data 33: TSS groups FPKM tracking
885 lines
format: tabular, database: Populus_unmasked
Info: cuffdiff v1.3.0 (3022)
cuffdiff -q -p 4 -c 1000 --FDR 0.050000 /mnt/spruce/storage/ftp/database/files/001/dataset_1429.dat /mnt/spruce/storage/ftp/database/files/001/dataset_1414.dat /mnt/spruce/storage/ftp/database/files/001/dataset_1416.dat
1234567891011121314151617
tracking_idclass_codenearest_ref_idgene_idgene_short_nametss_idlocuslengthcoverageq1_FPKMq1_conf_loq1_conf_hiq1_statusq2_FPKMq2_conf_loq2_conf_hiq2_status
TSS1--XLOC_000001POPTR_0001s00410TSS1scaffold_1:310722-311502--000OK3939.43154.9067723.95OK
TSS10--XLOC_000009POPTR_0001s11950TSS10scaffold_1:9286924-9287524--3087.1107435.85OK1817.5904514.23OK
TSS100--XLOC_000085POPTR_0001s31220TSS100scaffold_1:29549875-29550355--000OK12412.83060.321765.4OK
TSS101--XLOC_000085POPTR_0001s31220TSS101scaffold_1:29550486-29551345--977.75202444.38OK9951.122007.3617894.9OK
TSS102--XLOC_000086POPTR_0001s31700TSS102scaffold_1:30054810-30055383--2901.3907142.76OK5884.2011796.3OK
41: Cuffdiff on data 18, data 20, and data 33: CDS FPKM tracking
1 line
format: tabular, database: Populus_unmasked
Info: cuffdiff v1.3.0 (3022)
cuffdiff -q -p 4 -c 1000 --FDR 0.050000 /mnt/spruce/storage/ftp/database/files/001/dataset_1429.dat /mnt/spruce/storage/ftp/database/files/001/dataset_1414.dat /mnt/spruce/storage/ftp/database/files/001/dataset_1416.dat
123456789
tracking_idclass_codenearest_ref_idgene_idgene_short_nametss_idlocuslengthcoverage
42: Cuffdiff on data 18, data 20, and data 33: splicing diff
885 lines
format: tabular, database: Populus_unmasked
Info: cuffdiff v1.3.0 (3022)
cuffdiff -q -p 4 -c 1000 --FDR 0.050000 /mnt/spruce/storage/ftp/database/files/001/dataset_1429.dat /mnt/spruce/storage/ftp/database/files/001/dataset_1414.dat /mnt/spruce/storage/ftp/database/files/001/dataset_1416.dat
1234567891011121314
test_idgene_idgenelocussample_1sample_2statusvalue_1value_2sqrt(JS)test_statp_valueq_valuesignificant
TSS1XLOC_000001POPTR_0001s00410scaffold_1:310722-311502q1q2NOTEST000001no
TSS10XLOC_000009POPTR_0001s11950scaffold_1:9286924-9287524q1q2NOTEST000001no
TSS100XLOC_000085POPTR_0001s31220scaffold_1:29549875-29550355q1q2NOTEST000001no
TSS101XLOC_000085POPTR_0001s31220scaffold_1:29550486-29551345q1q2NOTEST000001no
TSS102XLOC_000086POPTR_0001s31700scaffold_1:30054810-30055383q1q2NOTEST000001no
43: Cuffdiff on data 18, data 20, and data 33: promoters diff
772 lines
format: tabular, database: Populus_unmasked
Info: cuffdiff v1.3.0 (3022)
cuffdiff -q -p 4 -c 1000 --FDR 0.050000 /mnt/spruce/storage/ftp/database/files/001/dataset_1429.dat /mnt/spruce/storage/ftp/database/files/001/dataset_1414.dat /mnt/spruce/storage/ftp/database/files/001/dataset_1416.dat
1234567891011121314
test_idgene_idgenelocussample_1sample_2statusvalue_1value_2sqrt(JS)test_statp_valueq_valuesignificant
XLOC_000001XLOC_000001POPTR_0001s00410scaffold_1:310722-311502q1q2NOTEST000001no
XLOC_000002XLOC_000002POPTR_0001s03980scaffold_1:3166391-3167041q1q2NOTEST000001no
XLOC_000003XLOC_000003POPTR_0001s04130scaffold_1:3265487-3266137q1q2NOTEST000001no
XLOC_000004XLOC_000004POPTR_0001s04180scaffold_1:3311931-3312468q1q2NOTEST000001no
XLOC_000005XLOC_000005POPTR_0001s11010scaffold_1:8540146-8540883q1q2NOTEST000001no
44: Cuffdiff on data 18, data 20, and data 33: CDS diff
1 line
format: tabular, database: Populus_unmasked
Info: cuffdiff v1.3.0 (3022)
cuffdiff -q -p 4 -c 1000 --FDR 0.050000 /mnt/spruce/storage/ftp/database/files/001/dataset_1429.dat /mnt/spruce/storage/ftp/database/files/001/dataset_1414.dat /mnt/spruce/storage/ftp/database/files/001/dataset_1416.dat
1234567891011121314
test_idgene_idgenelocussample_1sample_2statusvalue_1value_2sqrt(JS)test_statp_valueq_valuesignificant