Published Histories | chanaka | Read random lines from fastq
Import history

Galaxy History ' Read random lines from fastq'


DatasetAnnotation
3: initial_fatsq_file.fq
220.8 Mb
format: fastqsanger, database: ?
Info: Joined 899422 of 899422 read pairs (100.00%).
@SOLEXA14:5:1:1:1424#0
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+SOLEXA14:5:1:1:1424#0
BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
@SOLEXA14:5:1:2:1420#0
CNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
None
4: FASTQ to Tabular
~900,000 lines
format: tabular, database: ?
Info: 899422 FASTQ reads were converted to Tabular.
123
SOLEXA14:5:1:1:1424#0NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
SOLEXA14:5:1:2:1420#0CNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
SOLEXA14:5:1:3:36#0GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN`BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
SOLEXA14:5:1:4:2005#0CGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNa`BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
SOLEXA14:5:1:5:1843#0AANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
SOLEXA14:5:1:6:1827#0AANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
None
5: Select random lines-lets take 50 lines
50 lines
format: tabular, database: ?
123
SOLEXA14:5:22:784:158#0ATTAATCTATTCAGATTGATACGTAGTCAATTTCATCAGCACCAAAGGAAAGTGGTCAATGATCTCAAGGGTGGTTATTGATTTTTCTTATTTATGATTTCCfggggggggggggggggggggggfgggggggggggggggggggggggggggggggeggdgfeggfgedegefgggggggggggggggdddggggggggggdg
SOLEXA14:5:23:1733:269#0CAGGGTGTGCCAAATGCTGCAGGTGAGGATCGCATTGGGTTCTACAAGACCGCCTGGAAGGGACAAAAGAAACATCTTATTCTTACTGGAGGAAATAGAAAAeaeeecgeggaaeaeggggcaca\cdgdgcfgcdgggegcfgfgee`eedZgdgeggffgggdggdceggbddggfgggggdgggfgfdggfgfggggffcg
SOLEXA14:5:60:1047:616#0GTCAACCCGGAAGAGCATTCTTGCAAGAAACTGCATAGGATCTCTTCTTTCGACACTAATACCATGAATTTCATATCGTATCCTCCAAATACAGTTTCTATG_\fgggfggg_dcefbeaeaefaZcZ\XZXbcffecgeggegag_edagge]^__`]_]\`afefce_eeegggggggggg^^`Y_efaebfeeddeegggg
SOLEXA14:5:61:747:36#0GGTTTTCGAACAGAAGAGGCAGCGCAGCTATCCAAGCAGAAACAATGGCTAGAGATAGTGACGAGTTTTCTTGTCGGAGCCATAACCAATGTTTGGCATCAAaMaWed`^aacggggfgggggggegggeecafacfbegggggg^fcggcgfeg]dgggga\\`^Vcbceaef]egggdggghgggce_eeagegdgdddeee
SOLEXA14:5:64:942:129#0GCCACCCTCAACCTCAATGCCATGAACAAACTAAACACCAAGAAGCCATGGACTTTGAAATGACGGGACTTCTTAGTACTTGTAGTCCTTGACGTGGAGGCTggeg\ee_eegaegceffffdgeegggggfgeggg_e_bbggggg_dg`cgffg`gfecgge`\deggdcg__\\`^cacagggddgggdg]^a_[[^BBBB
SOLEXA14:5:69:869:1838#0CTCTCTTGGCTTTCAAAGAAGCCACTGGGATCTTGCTCAGAACCTTAGCATTTCTCATGATTATTGCCGGATTGTGGGTCCTGTCAATTGTGGGGAGTTCGTgggcggaddghgdgggaggggdggffca\fdggddefggd^gfgf`dage\\gggedgaggggggfggggdgggcaggaggggfgfdfggfghegegf_gea
None
6: Tabular to FASTQ
50 sequences
format: fastqsanger, database: ?
Info: 50 tabular lines were written as FASTQ reads. Be sure to use the FASTQ Groomer tool on this output before further analysis.
@SOLEXA14:5:22:784:158#0
ATTAATCTATTCAGATTGATACGTAGTCAATTTCATCAGCACCAAAGGAAAGTGGTCAATGATCTCAAGGGTGGTTATTGATTTTTCTTATTTATGATTTCC
+
fggggggggggggggggggggggfgggggggggggggggggggggggggggggggeggdgfeggfgedegefgggggggggggggggdddggggggggggdg
@SOLEXA14:5:23:1733:269#0
CAGGGTGTGCCAAATGCTGCAGGTGAGGATCGCATTGGGTTCTACAAGACCGCCTGGAAGGGACAAAAGAAACATCTTATTCTTACTGGAGGAAATAGAAAA
None
7: FASTQ splitter on -left
50 sequences
format: fastqsanger, database: ?
Info: Split 50 of 50 reads (100.00%).
@SOLEXA14:5:22:784:158#0/1
ATTAATCTATTCAGATTGATACGTAGTCAATTTCATCAGCACCAAAGGAAA
+
fggggggggggggggggggggggfggggggggggggggggggggggggggg
@SOLEXA14:5:23:1733:269#0/1
CAGGGTGTGCCAAATGCTGCAGGTGAGGATCGCATTGGGTTCTACAAGACC
None
40: Popgenie Bulktools results
10 lines
format: tabular, database: ?
12
IDAgriGO
POPTR_0002s11160.1GO:0005575-cellular_component;GO:0003674-molecular_function;GO:0008150-biological_process;
POPTR_0007s07730.1GO:0003735-structural constituent of ribosome;GO:0005840-ribosome;GO:0006412-translation;GO:0005622-intracellular;
POPTR_0006s13370.1GO:0003735-structural constituent of ribosome;GO:0005840-ribosome;GO:0006412-translation;GO:0005622-intracellular;
POPTR_0006s11770.1GO:0008270-zinc ion binding;GO:0005622-intracellular;
POPTR_0002s19720.1GO:0003700-sequence-specific DNA binding transcription factor activity;GO:0043565-sequence-specific DNA binding;GO:0046983-protein dimerization activity;GO:0005634-nucleus;GO:0006355-regulation of transcription, DNA-dependent;