Published Histories | chanaka | popgenie random fastq extract tool
Import history

Galaxy History ' popgenie random fastq extract tool'


DatasetAnnotation
1: input pair 1
136.7 Mb
format: fastqsanger, database: ?
Info: Groomed 899422 sanger reads into sanger reads.Based upon quality and sequence, the input data is valid for: solexa, sanger, illuminaInput ASCII range: 'B'(66) - 'h'(104)Input decimal range: 33 - 71
@SOLEXA14:5:1:1:1424#0/1
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+SOLEXA14:5:1:1:1424#0/1
BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
@SOLEXA14:5:1:2:1420#0/1
CNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
None
2: input pair 2
136.7 Mb
format: fastqsanger, database: ?
Info: Groomed 899422 sanger reads into sanger reads.Based upon quality and sequence, the input data is valid for: solexa, sanger, illuminaInput ASCII range: 'B'(66) - 'h'(104)Input decimal range: 33 - 71
@SOLEXA14:5:1:1:1424#0/2
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+SOLEXA14:5:1:1:1424#0/2
BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
@SOLEXA14:5:1:2:1420#0/2
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
None
25: Random fastq extract tool on data 2 and data 1
13.7 Mb
format: fastqsanger, database: ?
@SOLEXA14:5:1:15:519#0/1
CCCATGCCGCGCTTGCCTGACTCCAGNNNNNGTCTTGCNTCNNNNNNNNNN
+SOLEXA14:5:1:15:519#0/1
BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
@SOLEXA14:5:1:17:530#0/1
TGGTTGCCATTGCTCCATGGCGACGGACATAAATGATAATGCAATAGAANN
26: Random fastq extract tool on data 2 and data 1
13.7 Mb
format: fastqsanger, database: ?
@SOLEXA14:5:1:15:519#0/2
CCTATGTAATTAAGCTTCTGTTTTAGCTATTTTCCTCACGTAAGAGGCGTG
+SOLEXA14:5:1:15:519#0/2
BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
@SOLEXA14:5:1:17:530#0/2
ATCAATCATCAAATGTTTCATATATTCAAGACGCGAATCGGTTTGTTTTGC