Published Histories | chanaka | Basic steps RNASeq Analysis
Import history

Galaxy History ' Basic steps RNASeq Analysis'


DatasetAnnotation
2: asp5_leaf_read1.fq
13.7 Mb
format: fastqsanger, database: Populus_unmasked
@SOLEXA14:5:1:11:122#0/1
GCCTTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+SOLEXA14:5:1:11:122#0/1
BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
@SOLEXA14:5:1:22:127#0/1
TGGGAAGCCGTCTGAAATCCCAACTCGCTTTCATTGCTGGTACAGTACCCA
Aspen leaves paired-end reads (2 into 50 bp) and the target insert size was 200 bp.
19: FASTQ Groomer on data 2
13.7 Mb
format: fastqsanger, database: Populus_unmasked
Info: Groomed 89852 illumina reads into sanger reads.
Based upon quality and sequence, the input data is valid for: solexa, sanger, illumina
Input ASCII range: 'B'(66) - 'h'(104)
Input decimal range: 2 - 40
@SOLEXA14:5:1:11:122#0/1
GCCTTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+SOLEXA14:5:1:11:122#0/1
###################################################
@SOLEXA14:5:1:22:127#0/1
TGGGAAGCCGTCTGAAATCCCAACTCGCTTTCATTGCTGGTACAGTACCCA
20: Compute quality statistics on data 19
52 lines
format: txt, database: Populus_unmasked
column count min max sum mean Q1 med Q3 IQR lW rW A_Count C_Count G_Count T_Count N_Count Max_count
1 89852 2 40 2963174 32.98 33 38 39 6 24 40 29609 21160 25194 13561 328 89852
2 89852 2 40 2941738 32.74 34 38 39 5 27 40 26077 14037 23413 25207 1118 89852
3 89852 2 40 2930483 32.61 33 38 39 6 24 40 25037 21760 18083 23360 1612 89852
4 89852 2 40 2928900 32.60 33 38 39 6 24 40 25366 19943 19411 23247 1885 89852
5 89852 2 40 2926145 32.57 33 38 39 6 24 40 25639 18866 20135 23086 2126 89852
21: Draw quality score boxplot on data 20
22.0 Kb
format: png, database: Populus_unmasked
Image in png format
22: Draw nucleotides distribution chart on data 20
11.9 Kb
format: png, database: Populus_unmasked
Image in png format