Galaxy History ' Extract Intron'


DatasetAnnotation
1: Ptrichocarpav2_0_intron.gff3
~160,000 lines
format: gff3, database: Populus_unmasked
Info: using make_intron_feature.pl
1.Seqid2.Source3.Type4.Start5.End6.Score7.Strand8.Phase9.Attributes
##gff-version 3
scaffold_1Ptrichocarpav2_0intron1265112767.+.ID=POPTR_0001s00200.1.i1;Gene=POPTR_0001s00200
scaffold_1Ptrichocarpav2_0intron1289213116.+.ID=POPTR_0001s00200.1.i2;Gene=POPTR_0001s00200
scaffold_1Ptrichocarpav2_0intron1322713309.+.ID=POPTR_0001s00200.1.i3;Gene=POPTR_0001s00200
scaffold_1Ptrichocarpav2_0intron7423674358.+.ID=POPTR_0001s00220.1.i1;Gene=POPTR_0001s00220
scaffold_1Ptrichocarpav2_0intron7463575258.+.ID=POPTR_0001s00220.1.i2;Gene=POPTR_0001s00220
perl make_intron_feature.pl -u [uname]-p [pass] -db gbrowse2_JGIv129 -oPtrichocarpav2_0_intron.gff3
8: intron.fasta
110,757 sequences
format: fasta, database: Populus_unmasked
Info: Extracted fatsa for intron
>POPTR_0001s00200.1.i1 scaffold_1:12651..12767 length=117
GTGATTTTGGAGCTCAATTCCACCATCGCATGCTCATATATCACATCCACATGAATCTTTGACTCTTAATTCTGAGTTTGATTTCTTCCTTCACATCTGTTCTGGTTTTCAAATCAG
>POPTR_0001s00200.1.i2 scaffold_1:12892..13116 length=225
GTTTTCCATTCCACCATATATAAACTGCATCGATTTTAATAATTTGGGACAATCCCGCCTACAAGGAGAAACCAGACCAGTTCGTGTTATTTGTCCGATCGATCTACATTGAATCATTATAAGCAGTTAGAATGTTGCTTAATTTGTTTTAATTAAGATCCCCTTTCATCAAAATACTTTTATAGAAATCACTTTCTTCTGTCTATTAATTATTGTTTGAAGCAG
>POPTR_0001s00200.1.i3 scaffold_1:13227..13309 length=83
GTAAGGTATTCGGTATAATATTTCTGGCACAAATTATTAATGAACTCCTCGTATTAATATAGATTTAATTGTTTTGGTTGCAG
perl exttract_seq_from_gff3.pl -d genomefastafile.fa - inputgff3file.gff3 > outputfastafile.fa